Saltar al contenido principal

Repeated 10 Character Substrings

Given a string s, return all of its repeated 10 character substrings.

Note: You may assume s only contains uppercase alphabetical characters.

Example(s)

Example 1:

Input: s = "BBBBBBBBBBB"
Output: ["BBBBBBBBBB"]
Explanation:
The string has 11 characters. The 10-character substring "BBBBBBBBBB" appears:
- At position 0-9: "BBBBBBBBBB"
- At position 1-10: "BBBBBBBBBB"
Since it appears more than once, it's included in the result.

Example 2:

Input: s = "ABABABABABABBBBBBBBBBB"
Output: ["ABABABABAB","BBBBBBBBBB"]
Explanation:
10-character substrings that appear more than once:
- "ABABABABAB" appears at positions 0-9 and 2-11
- "BBBBBBBBBB" appears multiple times in the last part

Example 3:

Input: s = "AAAAACCCCCAAAAACCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC","CCCCCAAAAA"]
Explanation:
- "AAAAACCCCC" appears twice
- "CCCCCAAAAA" appears twice

Solution

The solution uses a sliding window with hash map:

  1. Sliding window: Extract all substrings of length 10
  2. Count occurrences: Use a hash map to count how many times each substring appears
  3. Filter repeated: Return all substrings that appear more than once
  4. Avoid duplicates: Use a set to return unique repeated substrings

JavaScript Solution - Sliding Window

/**
* Find all repeated 10-character substrings
* @param {string} s - Input string
* @return {string[]} - Array of repeated 10-character substrings
*/
function findRepeatedDnaSequences(s) {
if (s.length < 10) {
  return [];
}

const substringCount = new Map();

// Extract all 10-character substrings using sliding window
for (let i = 0; i <= s.length - 10; i++) {
  const substring = s.substring(i, i + 10);
  substringCount.set(substring, (substringCount.get(substring) || 0) + 1);
}

// Find all substrings that appear more than once
const result = [];
for (const [substring, count] of substringCount.entries()) {
  if (count > 1) {
    result.push(substring);
  }
}

return result;
}

// Test cases
console.log('Example 1:', findRepeatedDnaSequences("BBBBBBBBBBB")); 
// ["BBBBBBBBBB"]

console.log('Example 2:', findRepeatedDnaSequences("ABABABABABABBBBBBBBBBB")); 
// ["ABABABABAB","BBBBBBBBBB"]

console.log('Example 3:', findRepeatedDnaSequences("AAAAACCCCCAAAAACCCCCAAAAAGGGTTT")); 
// ["AAAAACCCCC","CCCCCAAAAA"]

console.log('Test 4:', findRepeatedDnaSequences("AAAAAAAAAAA")); 
// ["AAAAAAAAAA"]

console.log('Test 5:', findRepeatedDnaSequences("ABCDEFGHIJ")); 
// [] (no repeats)
Output:
Click "Run Code" to execute the code and see the results.

Alternative Solution (Using Set)

Here's a version that uses sets to track seen and repeated substrings:

/**
* Using sets to track seen and repeated substrings
*/
function findRepeatedDnaSequencesSet(s) {
if (s.length < 10) {
return [];
}

const seen = new Set();
const repeated = new Set();

// Extract all 10-character substrings
for (let i = 0; i <= s.length - 10; i++) {
const substring = s.substring(i, i + 10);

if (seen.has(substring)) {
// Already seen, so it's repeated
repeated.add(substring);
} else {
// First time seeing this substring
seen.add(substring);
}
}

return Array.from(repeated);
}

Complexity

  • Time Complexity: O(n) - Where n is the length of the string. We iterate through the string once, and each substring operation is O(10) = O(1).
  • Space Complexity: O(n) - In the worst case, we might store all unique substrings. The hash map/set can contain up to n-9 entries.

Approach

The solution uses a sliding window with hash map:

  1. Sliding window:

    • Iterate through the string
    • Extract each 10-character substring starting at position i
  2. Count occurrences:

    • Use a hash map to count how many times each substring appears
    • Key: substring, Value: count
  3. Filter repeated:

    • Iterate through the hash map
    • Add substrings that have count > 1 to the result
  4. Return result:

    • Return array of repeated substrings

Key Insights

  • Sliding window: Extract all substrings of fixed length (10)
  • Hash map: Efficiently count occurrences
  • Repeated means count > 1: Not just appearing twice, but appearing multiple times
  • Fixed length: All substrings are exactly 10 characters
  • O(n) time: Single pass through the string

Step-by-Step Example

Let's trace through Example 1: s = "BBBBBBBBBBB" (11 characters)

String: "BBBBBBBBBBB" (indices 0-10)

Step 1: Extract all 10-character substrings
i = 0: substring = s[0:10] = "BBBBBBBBBB"
i = 1: substring = s[1:11] = "BBBBBBBBBB"

Step 2: Count occurrences
substringCount = {
"BBBBBBBBBB": 2
}

Step 3: Filter repeated (count > 1)
"BBBBBBBBBB" has count 2 > 1 ✓
Result: ["BBBBBBBBBB"]

Final: ["BBBBBBBBBB"]

Visual Representation

Example 1: s = "BBBBBBBBBBB"

Positions: 0 1 2 3 4 5 6 7 8 9 10
String: B B B B B B B B B B B

Substring at i=0: [BBBBBBBBBB] (positions 0-9)
Substring at i=1: [BBBBBBBBBB] (positions 1-10)

Both are "BBBBBBBBBB" → appears 2 times → repeated ✓

Example 2: s = "ABABABABABABBBBBBBBBBB"

First part: "ABABABABABAB"
Substring at i=0: "ABABABABAB" (positions 0-9)
Substring at i=2: "ABABABABAB" (positions 2-11) → repeated ✓

Second part: "BBBBBBBBBB"
Multiple overlapping "BBBBBBBBBB" substrings → repeated ✓

Edge Cases

  • String length < 10: Return empty array (no 10-character substrings possible)
  • String length = 10: Check if it appears (it can't, since there's only one substring)
  • No repeats: Return empty array
  • All same character: If length >= 11, the substring will be repeated
  • All unique: No repeated substrings

Important Notes

  • Fixed length: All substrings must be exactly 10 characters
  • Repeated means > 1: Substring must appear at least twice
  • Overlapping allowed: Substrings can overlap (as in Example 1)
  • Case sensitive: Problem states uppercase only, but solution works for any case
  • Order: Result order may vary (can sort if needed)

Optimization: Early Termination

If we only need to know if a substring is repeated (not the count), we can use sets:

// More memory efficient if we don't need exact counts
const seen = new Set();
const repeated = new Set();

for (let i = 0; i <= s.length - 10; i++) {
const substring = s.substring(i, i + 10);
if (seen.has(substring)) {
repeated.add(substring);
} else {
seen.add(substring);
}
}
  • Longest Substring Without Repeating Characters: Different problem
  • Repeated DNA Sequences: Similar problem (LeetCode 187)
  • Find All Anagrams in a String: Different sliding window problem
  • Minimum Window Substring: Different constraint

Takeaways

  • Sliding window extracts all substrings of fixed length
  • Hash map efficiently counts occurrences
  • O(n) time is optimal (must check all substrings)
  • Fixed length simplifies the problem
  • Repeated means count > 1, not just appearing twice